• Users Online: 198
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 

 Table of Contents  
ORIGINAL ARTICLE
Year : 2019  |  Volume : 8  |  Issue : 1  |  Page : 18-23

The effect of ibuprofen on expression of Cox-1/2-related miRNAs in MKN- 45 -derived cancer stem-like cells


Department of Biology, Faculty of Science, Razi University, Kermanshah, Iran

Date of Web Publication28-Mar-2019

Correspondence Address:
Hassan Akrami
Department of Biology, Faculty of Science, Razi University, Kermanshah
Iran
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jrptps.jrptps_9_18

Rights and Permissions
  Abstract 

Context: Ibuprofen is an anti-inflammatory drug that non-selectively blocks cyclooxygenases-1/2 (COX-1/2) enzymes and thus reduces the risk tumorigenesis. This study was designed to detect microRNAs (miRNAs) that target Cox-1/2 mRNA and to investigate the effect of ibuprofen on the expression of the miRNAs in MKN-45-derived gastric cancer stem-like cells (CSLCs). We were also aimed to find signaling pathways modulated by the miRNAs. Subjects and Methods: The miRWalk database was used to recognize miRNAs that targeted Cox-1/2 genes. CSLCs were derived from MKN-45 cell line and were then treated with ibuprofen. Consequently, the effect of ibuprofen was evaluated on the expression of the miRNAs by quantitative real-time polymerase chain reaction (qRT-PCR). Finally, DIANA tools were used to identify signaling pathways that modulated by the miRNAs. Results: Our bioinformatic investigation showed that hsa-mir-16-5p, hsa-mir-483-5p, and hsa-mir-4669 targeted both Cox-1 and Cox-2 mRNAs. The qRT-PCR results indicated that hsa-mir-16-5p and hsa-mir-4669 were overexpressed 2.34 and 9.47 folds, respectively, while hsa-mir-483-5p under-expressed (2.08 folds) in ibuprofen-treated CSLCs relative to untreated cells. Moreover, it found that these miRNAs are involved in PI3K-Akt, P53, transforming growth factor-beta, phosphatidylinositol and insulin signaling pathways, cell cycle, extracellular matrix receptor interaction, gap junction, small cell lung cancer, prostate cancer, and chronic myeloid leukemia. Conclusions: We suggest that ibuprofen may reduce the risk of gastric cancer by affecting the expression of miRNAs that target Cox-1/2. however, further research is necessary to unravel its exact effects.

Keywords: Cancer stem-like cells, hsa-mir-16-5p, hsa-mir-4669, hsa-mir-483-5p, ibuprofen, microRNA


How to cite this article:
Akrami H, Karimi B, Salehi Z, Sisakhtnezhad S. The effect of ibuprofen on expression of Cox-1/2-related miRNAs in MKN- 45 -derived cancer stem-like cells. J Rep Pharma Sci 2019;8:18-23

How to cite this URL:
Akrami H, Karimi B, Salehi Z, Sisakhtnezhad S. The effect of ibuprofen on expression of Cox-1/2-related miRNAs in MKN- 45 -derived cancer stem-like cells. J Rep Pharma Sci [serial online] 2019 [cited 2023 Mar 26];8:18-23. Available from: https://www.jrpsjournal.com/text.asp?2019/8/1/18/255058


  Introduction Top


MicroRNAs (miRNAs) are a class of small endogenous noncoding RNAs that play a crucial role in the posttranscriptional regulation of genes.[1] Some miRNAs regulate cell proliferation and apoptosis processes, which are important in cancer formation and progression, by targeting oncogenes and tumor suppressor genes. These miRNAs function as oncogenes or tumor suppressors and thus named Oncomir and tumor suppressor miRNA, respectively.[2] Recent studies have been shown that some miRNAs play important roles as tumor suppressors or oncogenes in different cancers such as gastric cancer.[3] Liu et al. found that the expression profile of miRNAs was changed in MKN-45-derived cancer stem-like cells (CSLCs) relative to the MKN-45 cells.[4] Cancer stem cells (CSCs) are defined as the unique subpopulation in the tumors that can initiate tumor formation. They have self-renew potency and can also differentiate into various kinds of cells.[5] CSCs also induce the growth, metastasis, and chemo- and radio-resistant of tumors.[6] In this regard, it has also been found that miRNAs have a crucial role in the function of CSCs through regulating the expression of different genes involved in the CSC characteristics and functions.[7]

Ibuprofen is a member of nonsteroidal anti-inflammatory drugs derived from propionic acid and is a nonselective inhibitor of COX, an enzyme involved in prostaglandin synthesis through the arachidonic acid pathway.[8] Indeed, ibuprofen inhibits hydrophobic channel isozyme COX through direct interaction with the channel.[9],[10] COX is a key enzyme for conversion of arachidonic acid to prostaglandins and has two isozymes COX-1 and COX-2.[11] It has been found that overexpression of COX-2 in cancer cell lines promotes their ability to invade surrounding tissues as well as increases cell invasion in gastric cancer.[12] Ibuprofen inactivates COX-2 and thereby inhibits cancer cell proliferation.[13] It is also able to induce apoptosis in cancerous cells and to inhibit angiogenesis in gastric cancer.[14],[15] Although the exact mechanism of action of ibuprofen is remained to be clarified, it found that oncomir and tumor suppressor miRNA expression was changed in the ibuprofen-treated CSCs. For example, ibuprofen delays the development of tactile allodynia and suppresses spinal miR-155 in a rat model.[16] It showed that some miRNAs downregulated the expression of Cox-1 and Cox-2 genes and thereby inhibited cell invasion.[17] For example, COX-2 is a target of hsa-mir-16 in human hepatoma.[18] Given the importance of ibuprofen in regulating the expression of miRNAs in cells, this study was aimed to find miRNAs that target Cox-1/ 2 mRNA and to evaluate the effect of ibuprofen on the expression of the miRNAs in MKN-45-derived CSLCs. As well as, it was attempted to identify the signaling pathways that modulated by the miRNAs. In the current study, bioinformatic analysis was performed to find miRNAs that target Cox-1/ 2 mRNA. Consequently, we selected hsa-mir-16-5p, hsa-mir-4669, and hsa-mir-483-5p and then studied the effect of ibuprofen on the expression of these miRNAs in MKN-45-derived CSLCs. Finally, bioinformatic investigation was used to identify the signaling pathways that affected by these miRNAs.


  Materials and Methods Top


Bioinformatic analysis to find microRNAs and their affected signaling pathways

In the current study, different online databases were used to recognize miRNAs that target Cox-1/ 2 mRNAs and to find the signaling pathways that affected by the identified miRNAs. We used miRWalk, microT4, miRmap, PITA, RNA 22, TargetScan, and RNA hybrid in the miRWalk database (http://zmf.umm.uni-heidelberg.de/apps/zmf/mirwalk2/) to identify miRNAs that target Cox-1/ 2 mRNAs. The results were filtered and miRNAs with P ≤ 0.05 were selected from the list. After miRNA selection, the signaling pathways that affected by the selected miRNAs were obtained using DIANA tools (http://diana.imis.athena-innovation.gr/DianaTools).

Isolation and culture of MKN-45-derived cancer stem-like cells

The MKN-45 cell line was obtained from Pastor Institute (Tehran, Iran) and cultured in Dulbecco's modified Eagle medium/F12 supplemented with 10% fetal bovine serum (Gibco, Germany), penicillin (100 U/mL), and streptomycin 100 μg/mL (Sigma, Germany). To isolate CSLCs, the MKN-45 cells were cultured on the nonadhesive surface of 10 cm 2 culture plastic dishes coated with agarose (1.5%) (Sigma, Germany) and incubated at 37°C and 5% CO2 for 2 weeks. The culture medium was changed every 3 days until the sphere formation, which was the indication for the presence of CSLCs in culture.[19]

Treatment of cancer stem-like cells with ibuprofen

To investigate the effect of ibuprofen on the expression of miRNAs in the MKN-45-derived CSLCs, they were treated with 700 μM of the compound. The ibuprofen-treated CSLCs were then incubated at 37°C and 5% CO2 for 48 h.

Gene expression analysis

Total RNA was extracted from ibuprofen-treated and untreated CSLCs using a Qiagen RNeasy Mini Kit (Qiagen, USA) according to the manufacturer's instructions. Reverse transcriptase reactions were performed by specific stem-loop RT primer, including 5'-GTCGTATCCAGTGCAGGGTCCGA GGTATTCGCACTGGATACGACCGCCAA-3', 5'-GTCGTATCCAGTGCAGGGTCCGAGGT ATTCGCACTGGATACGACCTCCCT-3', and 5'-G TCGTATCCAGTGCAGGGTCCGAGGTATTCGC ACTGGATACGACCCTCCT-3' for hsa-mir-16-5p, hsa-mir-483-5p, and hsa-mir-4669, respectively. The effect of ibuprofen on the expression of miRNAs was evaluated using specific primers in quantitative real-time polymerase chain reaction (qRT-PCR). The nucleotide sequences of the forward primers were 5'-CGCGCTAGCAGCACGTAAAT-3', 5'-GTGCGTAAGACGGGAGGAAAGA-3', and 5'-C GCATAGTCCGGGAAGTGGAG-3' for hsa-mir- 16-5p, hsa-mir-483-5p, and hsa-mir-4669, respectively. In addition, a reverse universal primer contained 5'-GTGCAGGGTCCGAGGT-3' nucleotide sequence was used for all miRNAs. In this study, glyceraldehyde-3-phosphate dehydrogenase (forward primer: 5'-ACTCTGGTAAAGTGGATATTGTTGC-3' and reverse primer: 5'-GGAAGATGGTGATGGGATTTC-3') was also used as an endogenous control for relative quantification of gene expression by RT-PCR [Table 1]. In this study, the expression level of miRNAs relative to the internal control was assessed using Livak et al. method.[20]
Table 1: The sequences of miRNA sequence, primers and PCR product length

Click here to view


Statistical analysis

In the present study, statistical analysis was performed using SPSS software (version 16.0) through a Student's t-test. Data were presented as mean ± standard deviation and P value cutoffs <0.05 were used to identify statistically significant data.


  Results Top


Cancer stem-like cell formation and ibuprofen treatment

CSLCs were derived from gastric cell line MKN-45 during 2 weeks after cells seeded on nonadhesive agarose-coated plastic dishes. This culture condition was prevented MKN-45 from adhering to the dish surface and led to producing spheroid body-forming cells, which also known as CSLCs [Figure 1]. Consequently, the produced CSLCs were treated with ibuprofen.
Figure 1: Derivation of cancer stem-like cells from gastric cancer cell line MKN-45. To obtain cancer stem-like cells, MKN-45 cells were cultured on agarose-coated plastic dishes. After 14 days, spheroid body-forming cells, which also known as cancer stem-like cells, were detected in culture

Click here to view


Bioinformatic analysis to identify microRNAs that target Cox-1/2

Our bioinformatic analysis showed that hsa-mir-16-5p, hsa-mir-483-5p, and hsa-mir-4669 targeted both Cox-1 and Cox-2 mRNAs (P ≤ 0.05). Results were shown in [Table 2]. Finally, hsa-mir-16-5p, hsa-mir-483-5p, and hsa-mir-4669 were selected to investigate the effect of ibuprofen on the expression of miRNAs in MKN-45-derived CSLCs.
Table 2: Bioinformatic analysis to identify miRNAs that target cyclooxygenase-1/2

Click here to view


MicroRNA expression analysis in ibuprofen-treated cancer stem-like cells in comparison to untreated samples

qRT-PCR was performed to evaluate the effect of ibuprofen on the expression of hsa-mir-16-5p, hsa-mir-483-5p, and hsa-mir-4669 in CSLCs [Figure 2]. The qRT-PCR results indicated that hsa-mir-16-5p and hsa-mir-4669 were upregulated 2.34 and 9.47 folds, respectively, whereas hsa-mir-483-5p (2.08 folds) underexpressed in ibuprofen-treated CSLCs relative to untreated cells [Figure 3].
Figure 2: The quantitation and melting raw data for quantitative real-time polymerase chain reaction of hsa-mir-16-5p, hsa-mir-4669, and hsa-mir-483-5p

Click here to view
Figure 3: Quantitative microRNA expression analysis in ibuprofen-treated cancer stem-like cells compared to untreated controls. The results of quantitative real-time polymerase chain reaction show that hsa-mir-16-5p and hsa-mir-4669 upregulated 2.34 and 9.47 folds, respectively, while hsa-mir-483-5p downregulated (2.08 folds) in ibuprofen-treated CSLCs relative to untreated controls

Click here to view


Signaling pathway analysis of hsa-mir-16-5p, hsa-mir-483-5p, and hsa-mir-4669

We used DIANA tools to identify signaling pathways influencing by hsa-mir-16-5p, hsa-mir-483-5p, and hsa-mir-4669. Results indicated that hsa-mir-16-5p was associated with PI3K-Akt, p53, mammalian target of rapamycin (mTOR), transforming growth factor-beta (TGF-β) and ErbB signaling pathways, cell cycle, small-cell lung cancer, and prostate cancer. Moreover, we found that hsa-mir-483-5p is related to PI3K-Akt signaling pathway, focal adhesion, extracellular matrix (ECM)-receptor interaction, gap junction, and prostate cancer. In addition, bioinformatic investigation showed that hsa-mir-4669 probably modulates phosphatidylinositol signaling system, insulin signal transduction, and chronic myeloid leukemia.


  Discussion Top


miRNAs are a class of ~22-nt endogenous noncoding small RNAs that are associated with the development and progression of a variety of human cancers such as gastric cancer.[3] It has been found that the expression profile of miRNAs in tumor initiation cells, CSCs, has differed from that in noncancerous cells.[4] In addition, Chemical compounds, such as Ibuprofen, by targeting of effectors-mediated signaling pathways, influence on proliferation, differentiation and apoptosis of CSCs, and thus act as anti-cancer drug.[15] Ibuprofen is a member of nonsteroidal anti-inflammatory drugs that used as a potential antitumor drug.[8] The effect of ibuprofen was investigated on cell proliferation, apoptosis, angiogenesis, and expression of stemness marker genes.[14] Mechanistically, it showed that ibuprofen works through inhibiting the COX enzymes.[13] Overexpression of COX-2 in cancer cell lines increased their ability to invade surrounding tissues. In addition, it promoted cell invasion in gastric cancer.[12] Despite these studies, the exact mechanism of action of ibuprofen is unknown, and therefore, this study was designed to detect miRNAs that target Cox-1/ 2 transcript and to find the signaling pathways associated with the identified miRNAs. In this regard, our bioinformatic investigation indicated that hsa-mir-16-5p, hsa-mir-483-5p, and hsa-mir-4669 posttranscriptionally modulate the expression of Cox-1/ 2 genes. Therefore, we evaluated the effect of ibuprofen on the expression of hsa-mir-16-5p, hsa-mir-483-5p, and hsa-mir-4669 in MKN-45-derived CSLCs using qRT-PCR. The results of the quantitative gene expression analysis indicated that ibuprofen induced the expression of hsa-mir-16-5p and hsa-mir-4669, while it reduced the expression of hsa-mir-483-5p in CSLCs. Interestingly, the highest level of upregulation was seen for hsa-mir-4669 in ibuprofen-treated CSLCs (9.47 folds) as compared with untreated controls. A previous study by Liu et al. demonstrated that miR-4669 is one of the miRNAs that upregulated in the spheroid-forming cells as compared to the parental cell line MKN-45.[4] Therefore, it is proposed that hsa-mir-4669 acts as a tumor suppressor miRNA. Collectively, our bioinformatic data and gene expression analysis indicated that ibuprofen may inhibit cancer initiation and progression through upregulation of hsa-mir-4669 and consequently downregulating the Cox-1/ 2 transcript. Moreover, bioinformatic investigation demonstrated that hsa-mir-4669 is related to regulation of the phosphatidylinositol and insulin signal transduction, and therefore, it proposes that hsa-mir-4669 may affect the CSLCs characteristics and functions through regulating these signaling pathways.

hsa-mir-16-5p is a tumor suppressor miRNA and it has been reported that hsa-mir-16-5p was downregulated in non-small cell lung cancer.[21] Our bioinformatic evaluation also showed that hsa-mir-16-5p is a potential regulator of Cox-1/ 2 expression, and thus, the effect of ibuprofen was assessed on the expression of mir-16-5p in the MKN-45-derived CSLCs. Results revealed that the expression of hsa-mir-16-5p was also upregulated 2.34 folds in ibuprofen-treated CSLCs as compared to untreated cells. Therefore, these data propose that ibuprofen probably affects CSLC biology through overexpression of hsa-mir-16-5p and downregulating the Cox-1/ 2 transcript. In addition, DIANA tools indicated that hsa-mir-16-5p modulates PI3K-Akt, p53, mTOR, TGF-β, and ErbB signaling pathways, and therefore, it can suggest that hsa-mir-16-5p probably influences on CSLC characteristics through regulating these signaling pathways.

In the present study, we also found that hsa-mir-483-5p posttranscriptionally regulated the expression of Cox-1/ 2 genes. Functionally, a previous study indicated that hsa-mir-483-5p acts as tumor suppressor miRNAs and reduced cell proliferation in adrenocortical carcinoma cell lines.[22] Hsa-mir-483-5p also suppresses cell proliferation through induction of G0/G1 arrest in glioma cells.[23] Moreover, upregulation of hsa-mir-483-5p is associated with poorer disease-specific survival.[24] According to the results of these studies, we expected that ibuprofen treatment upregulates hsa-mir-483-5p expression in CSLCs, but our findings revealed that the expression of hsa-mir-483-5p was decreased 2.08 folds in ibuprofen-treated CSLCs as compared to untreated samples. In addition, bioinformatic investigation showed that hsa-mir-483-5p is associated with PI3K-Akt signaling pathway, focal adhesion, gap junction, and ECM-receptor interaction. Therefore, we propose that ibuprofen may influence on the CSLC communications and interactions through downregulation of hsa-mir-483-5p.


  Conclusions Top


We deduce that ibuprofen may reduce the risk of gastric cancer through modulating the expression of hsa-mir-16-5p, hsa-mir-483-5p, and hsa-mir-4669 and thus by regulating Cox-1/ 2 expression and signaling pathways that are involved in cancer initiation and progression. However, the exact mechanism and the role of these regulations are needed to be elucidated in further study.

Acknowledgments

We would like to acknowledge and extend our gratitude to Diba Farahani for her contribution in completing this work.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Bartel DP. MicroRNAs: Target recognition and regulatory functions. Cell 2009;136:215-33.  Back to cited text no. 1
    
2.
Chen CZ. MicroRNAs as oncogenes and tumor suppressors. N Engl J Med 2005;353:1768-71.  Back to cited text no. 2
    
3.
Liao YL, Tsai KW, Lin WC. miRNAs in Gastric Cancer. Rijeka: INTECH Open Access Publisher; 2011.  Back to cited text no. 3
    
4.
Liu J, Ma L, Wang Z, Wang L, Liu C, Chen R, et al. MicroRNA expression profile of gastric cancer stem cells in the MKN-45 cancer cell line. Acta Biochim Biophys Sin (Shanghai) 2014;46:92-9.  Back to cited text no. 4
    
5.
Tan BT, Park CY, Ailles LE, Weissman IL. The cancer stem cell hypothesis: A work in progress. Lab Invest 2006;86:1203-7.  Back to cited text no. 5
    
6.
Kim Y, Joo KM, Jin J, Nam DH. Cancer stem cells and their mechanism of chemo-radiation resistance. Int J Stem Cells 2009;2:109-14.  Back to cited text no. 6
    
7.
DeSano JT, Xu L. MicroRNA regulation of cancer stem cells and therapeutic implications. AAPS J 2009;11:682-92.  Back to cited text no. 7
    
8.
Rainsford KD. Ibuprofen: Pharmacology, efficacy and safety. Inflammopharmacology 2009;17:275-342.  Back to cited text no. 8
    
9.
Prusakiewicz JJ, Duggan KC, Rouzer CA, Marnett LJ. Differential sensitivity and mechanism of inhibition of COX-2 oxygenation of arachidonic acid and 2-arachidonoylglycerol by ibuprofen and mefenamic acid. Biochemistry 2009;48:7353-5.  Back to cited text no. 9
    
10.
Rao P, Knaus EE. Evolution of nonsteroidal anti-inflammatory drugs (NSAIDs): Cyclooxygenase (COX) inhibition and beyond. J Pharm Pharm Sci 2008;11:81s-110s.  Back to cited text no. 10
    
11.
Hawkey CJ. COX-1 and COX-2 inhibitors. Best Pract Res Clin Gastroenterol 2001;15:801-20.  Back to cited text no. 11
    
12.
Murata H, Kawano S, Tsuji S, Tsuji M, Sawaoka H, Kimura Y, et al. Cyclooxygenase-2 overexpression enhances lymphatic invasion and metastasis in human gastric carcinoma. Am J Gastroenterol 1999;94:451-5.  Back to cited text no. 12
    
13.
Kerola M, Vuolteenaho K, Kosonen O, Kankaanranta H, Sarna S, Moilanen E, et al. Effects of nimesulide, acetylsalicylic acid, ibuprofen and nabumetone on cyclooxygenase-1- and cyclooxygenase-2-mediated prostanoid production in healthy volunteers ex vivo. Basic Clin Pharmacol Toxicol 2009;104:17-21.  Back to cited text no. 13
    
14.
Akrami H, Aminzadeh S, Fallahi H. Inhibitory effect of ibuprofen on tumor survival and angiogenesis in gastric cancer cell. Tumour Biol 2015;36:3237-43.  Back to cited text no. 14
    
15.
Mahmoodi F, Akrami H. Evaluate the inhibition effect of ibuprofen on metastasis and invasion in gastric cancer stem cells. Shahrekord Univ Med Sci J 2015;17:88-96.  Back to cited text no. 15
    
16.
El-Lithy GM, El-Bakly WM, Matboli M, Abd-Alkhalek HA, Masoud SI, Hamza M, et al. Prophylactic L-arginine and ibuprofen delay the development of tactile allodynia and suppress spinal miR-155 in a rat model of diabetic neuropathy. Transl Res 2016;177:85-97.  Back to cited text no. 16
    
17.
Cornett AL, Lutz CS. Regulation of COX-2 expression by miR-146a in lung cancer cells. RNA 2014;20:1419-30.  Back to cited text no. 17
    
18.
Agra Andrieu N, Motiño O, Mayoral R, Llorente Izquierdo C, Fernández-Alvarez A, Boscá L, et al. Cyclooxygenase-2 is a target of microRNA-16 in human hepatoma cells. PLoS One 2012;7:e50935.  Back to cited text no. 18
    
19.
Chen SF, Chang YC, Nieh S, Liu CL, Yang CY, Lin YS, et al. Nonadhesive culture system as a model of rapid sphere formation with cancer stem cell properties. PLoS One 2012;7:e31864.  Back to cited text no. 19
    
20.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 2001;25:402-8.  Back to cited text no. 20
    
21.
Fan L, Qi H, Teng J, Su B, Chen H, Wang C, et al. Identification of serum miRNAs by nano-quantum dots microarray as diagnostic biomarkers for early detection of non-small cell lung cancer. Tumour Biol 2016;37:7777-84.  Back to cited text no. 21
    
22.
Özata DM, Caramuta S, Velázquez-Fernández D, Akçakaya P, Xie H, Höög A, et al. The role of microRNA deregulation in the pathogenesis of adrenocortical carcinoma. Endocr Relat Cancer 2011;18:643-55.  Back to cited text no. 22
    
23.
Wang L, Shi M, Hou S, Ding B, Liu L, Ji X, et al. MiR-483-5p suppresses the proliferation of glioma cells via directly targeting ERK1. FEBS Lett 2012;586:1312-7.  Back to cited text no. 23
    
24.
Soon PS, Tacon LJ, Gill AJ, Bambach CP, Sywak MS, Campbell PR, et al. MiR-195 and miR-483-5p identified as predictors of poor prognosis in adrenocortical cancer. Clin Cancer Res 2009;15:7684-92.  Back to cited text no. 24
    


    Figures

  [Figure 1], [Figure 2], [Figure 3]
 
 
    Tables

  [Table 1], [Table 2]


This article has been cited by
1 Spirulina platensis Mitigates the Inhibition of Selected miRNAs that Promote Inflammation in HAART-Treated HepG2 Cells
Thabani Sibiya, Terisha Ghazi, Jivanka Mohan, Savania Nagiah, Anil A. Chuturgoon
Plants. 2022; 12(1): 119
[Pubmed] | [DOI]
2 Ibuprofen-loaded biocompatible latex membrane for drug release: Characterization and molecular modeling
Aline de Freitas Lima, Giovana Sant’Ana Pegorin, Matheus Carlos Romeiro Miranda, Joćo Paulo Cachaneski-Lopes, William de Melo Silva, Felipe Azevedo Borges, Nayrim Brizuela Guerra, Rondinelli Donizetti Herculano, Augusto Batagin-Neto
Journal of Applied Biomaterials & Functional Materials. 2021; 19: 2280800021
[Pubmed] | [DOI]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusions
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed3500    
    Printed272    
    Emailed0    
    PDF Downloaded485    
    Comments [Add]    
    Cited by others 2    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]