Growth inhibitory activity of Brassica oleracea var. Alboglabra on human gastric cancer cells

Dai-Hung Ngo; Hoang Nhat Minh Nguyen; Thi Nhat Hang Nguyen; Thi Lien Thuong Nguyen; Dai-Nghiep Ngo; Thanh Sang Vo

doi:10.4103/jrptps.JRPTPS_119_21

ORIGINAL ARTICLE

Year : 2022 | Volume : 11 | Issue : 2 | Page : 199-203

Growth inhibitory activity of Brassica oleracea var. Alboglabra on human gastric cancer cells

Dai-Hung Ngo¹, Hoang Nhat Minh Nguyen², Thi Nhat Hang Nguyen¹, Thi Lien Thuong Nguyen¹, Dai-Nghiep Ngo³, Thanh Sang Vo²
¹ Institute of Applied Technology, Thu Dau Mot University, Binh Duong Province, Ho Chi Minh City, Vietnam
² NTT Hi-Tech Institute, Nguyen Tat Thanh University, Ho Chi Minh City, Vietnam
³ Faculty of Biology and Biotechnology, University of Science, Vietnam National University, Ho Chi Minh City, Vietnam

Date of Submission	23-Aug-2021
Date of Acceptance	18-Jun-2022
Date of Web Publication	23-Dec-2022

Correspondence Address:
Prof. Dai-Nghiep Ngo
Faculty of Biology and Biotechnology, University of Science, Vietnam National University, Ho Chi Minh City
Vietnam

Source of Support: None, Conflict of Interest: None

Check

DOI: 10.4103/jrptps.JRPTPS_119_21

Abstract

Objectives: The aim of this study is to investigate anticancer activity of Brassica oleracea var. alboglabra (BOA) against the proliferation of BGC-823 human gastric cancer cells. Materials and Methods: B. oleracea var. alboglabra was extracted by ethanol 98% at a solid-to-liquid ratio of 1:8, (w/v) for 24h at room temperature. The cytotoxic effect of vegetables was examined by MTT assay. The migration of the cancer cells was conducted by wound healing assay and visualized under an inverted microscope. The mRNA expression level was quantified by real time PCR. Major Findings: It was found that ethanol extract of BOA exhibited the inhibitory activity against the proliferation of BGC-823 cells at IC₅₀ value of 217.6 ± 2.8 µg/ml. Moreover, the treatment of BOA extract at concentration of 100 µg/ml for 24 h significantly suppressed the migration of gastric cancer cells into the gap as compared to the untreated cell group. Notably, the cytotoxic effect of BOA extract on human gastric cancer cells was found due to induction of apoptosis, mediating the up-regulation of caspase-8, -9, -3, and Bax in cancer cells. Conclusion: These results indicated that B. oleracea var. alboglabra have the potential inhibitory activity against the development of gastric cancer.

Keywords: Anticancer, apoptosis, BGC-823 cells, Brassicaceae, vegetables

How to cite this article:
Ngo DH, Nguyen HN, Nguyen TN, Nguyen TL, Ngo DN, Vo T. Growth inhibitory activity of Brassica oleracea var. Alboglabra on human gastric cancer cells. J Rep Pharma Sci 2022;11:199-203

How to cite this URL:
Ngo DH, Nguyen HN, Nguyen TN, Nguyen TL, Ngo DN, Vo T. Growth inhibitory activity of Brassica oleracea var. Alboglabra on human gastric cancer cells. J Rep Pharma Sci [serial online] 2022 [cited 2023 Jun 6];11:199-203. Available from: https://www.jrpsjournal.com/text.asp?2022/11/2/199/364994

Introduction

In last decades, several types of cancers have been the top cause of death all around the world. Cancer treatment involves time, money and endures that can last for months or even years, and requires several types of drugs, therapies, surgeries. Therapies such as radioactive and chemotherapy not only destroy cancer cells but also damage healthy cells and tissues, which undoubtedly weaken the patients and worsen their overall health status.^[1] Thus, scientists and physicians have been studying new methods with higher efficiency, lower cost, and lower damage to patients. Dietary products are considered as potential factors in preventing, suppressing cancers, and supporting treatments.^[2] Especially, vegetables plants have a various nutrients and secondary metabolites which give additional benefits to human health status and prevent numerous chronic diseases, such as cancer.^[3]

Brassicaceae vegetables, a common part of human diet, are consumed by people around the world. Especially, Brassicaceae vegetables contain various phytochemicals such as amino acids, minerals, vitamins, polyphenols, flavonoids, carotenoids, alkaloids, phytosterols chlorophyll, glucosinolates, terpenoids, and glucosides.^[4] Thus, high intake of these vegetables can attenuate the cancer risk, cardiovascular, and other chronic diseases.^[5],[6] Among Brassicaceae vegetables with health benefits, Brassica oleracea var. alboglabra has been focused to study its health-promoting phytochemicals and antioxidant capacity.^[7],[8]B. oleracea var. alboglabra has been found as a potential source of glucosinolates, which exhibit anti-carcinogenicity by inhibiting the production of endogenous and exogenous carcinogens as well as inducing antioxidant.^[7],[8],[9] Thus, B. oleracea var. alboglabra may be suggested to possess the inhibitory activity against several types of cancer. However, the cytotoxicity of these vegetables on gastric cancer cells should be further investigated. For the first time, this study was proposed to investigate the anticancer activity of B. oleracea var. alboglabra against gastric cancer cells. Its activity was evidenced via inhibition of cell proliferation, suppression of cell migration, and induction of cell apoptosis. The result of this study will indicate new target of B. oleracea var. alboglabra toward gastric cancer cells, supporting its potential role in prevention and treatment of various cancers.

Materials and Methods

Materials

B. oleracea var. alboglabra was obtained from local greengrocer in Ho Chi Minh city, Vietnam. Human gastric cancer cells (BGC-823 cells) were donated by Chinese Academy of Sciences (Shanghai, China). Reagents for real time PCR were purchased from Qiagen (Hilden, Germany). Primers for qPCR were purchased from Intergrated DNA Technologies, Iowa, USA. The other one were purchased from Sigma-Aldrich (MO, USA).

Extraction

B. oleracea var. alboglabra (BOA) was air-dried under shade and the powder was extracted by ethanol 98% at a solid-to-liquid ratio of 1:8, (w/v) for 24h at room temperature. The ethanol extract with the humidity level of less than 12% were then hold at 4°C for further investigation.

Cytotoxic assay

The inhibitory effect of ethanol extract of BOA on BGC-823 cells was investigated by MTT method.^[10] Briefly, BGC-823 cells were cultured into 96-well plates (2 × 10⁵ cells/ml) before in

cubated with the extract for 24 h at different concentrations. The medium was then changed by 100 µl of MTT solution at final concentration of 0.5 mg/ml. After 4 h of incubation, the formed formazan salt was solubilized by DMSO (100 µl), and optical density was measured by a microplate reader (BioTek Instruments, USA) at 540 nm.

Inverted microscope observation

BGC-823 cells were cultured at density of 2 × 10⁵ cells/ml before treated with 200 µg/ml of BOA extract for one day. The cells were washed by PBS and the morphology was visualized under an inverted microscope (Oxion, Euromex, Netherlands).

Cell migration assay

This assay was conducted as reported by Kwak and Ju.^[11] Briefly, a monolayer of BGC-823 cells were scratched by a yellow tip. Subsequently, the cells were treated with BOA extract at concentration of 100 µg/ml for one day. Gap area was visualized under an inverted microscope (Oxion, Euromex, Netherlands).

Real time PCR

BGC-823 cells (2 × 10⁵ cells/ml) were treated with 100 µg/ml of BOA extract for a day. Total RNA from the treated cells was isolated by a commercial kit (Qiagen, Hilden, Germany). Subsequently, cDNA synthesis was performed according protocol of NEB (MA, USA). Each cycle of qPCR was conducted under the conditions of denaturation of 94 °C (30 s), annealing of 60 °C (30 s), and extension of 72 °C (30 s). The mRNA expression level of relative gene in the treated cells was respectively compared with that of the blank (without treatment). Primer for caspase-3 (F: TCGCTTTGTGCCATGCTGAA and R: ACTCAAATTCTGTTGCCACC); for caspase-8 (F: AATGGAACACACTTGGATGC and R: GCTCTACTGTGCAGTCATCG); for caspase-9 (F: TTGAGGACCTTCGACCAGCT and R: CAACG TACCAGGAGCCACTC); for Bax (F: CTGACGG CAACTTCAACTGG and R: CCAATGTCCAG CCCATGATG); for GAPDH (F: GGGCTCTCCA GAACATCATC and R: GGTCCACCACTGACA CGTTG).

Statistical analysis

The ANOVA test of SPSS was used for analysis of data. Tukey’s multiple range test was further assessed to identify statistical differences among groups at p < 0.05.

Results

The inhibitory effect of BOA extract on cell proliferation

To determine the inhibition of BOA extract on proliferation of human gastric cancer cells, BGC-823 cells were exposed by different dose of BOA extract for one day and MTT assay was conducted to identify the cytotoxic effect of BOA extract on the cells. The treatment of BOA extract caused a substantial suppression of cell growth at a concentration-dependent manner [Figure 1]A. The inhibitory effect of BGC-823 cell growth was determined IC₅₀ value of 217.6 ± 2.8 µg/ml. Moreover, cell morphology was observed to be changed as compared with the cells in blank group [Figure 1]B. The cell size was reduced, and cell boundary was disrupted as compared with the blank cells. It indicated that BOA extract could inhibit proliferation and cause injury and death in gastric cancer cells.

Figure 1: The inhibition of BOA extract on BGC-823 cell proliferation (A) and cell morphological change (B). (A) BGC-823 cells were exposed by various doses of BOA extract for one day and the IC₅₀ value was indicated by a linear regression equation. (B) BGC-823 cells were treated with BOA extract for one day and cell morphology was then visualized under an inverted microscope (10x magnification).

Click here to view

The suppression of BOA extract on cancer cell migration

In order to determine the inhibition of BOA extract on the migration of cancer cell, a cell-free area was conducted by a yellow pipette tip on a monolayer of BGC-823 cells. It was observed that the induction of the cell-free area caused the migration of the gastric cancer cells onto the gap area in the untreated cell group after 24 h culture [Figure 2]A & B. However, the treatment of BOA extract at concentration of 100 µg/ml meaningfully suppressed the migration of gastric cancer cells onto the gap area as compared to the untreated cell group [Figure 2]C & D. Thus, BOA extract was suggested to inhibit extracellular matrix production, causing suppression of the migration of gastric cancer cells.

Figure 2: The suppression of BOA extract on cell migration. BGC-823 cells were cultured on plates before a gap space was made by a yellow pipette tip. Cells were subsequently exposed by BOA extract for one day and the images of gap space were visualized under an inverted microscope (10x magnification)

Click here to view

Effect of BOA extract on apoptotic signaling molecules

To further clarify the inhibition of BOA extract on gastric cancer cell proliferation, expression of genes involved in apoptosis process was measured by qPCR. The treatment of BOA extract at concentration of 100 µg/ml for one day up-regulated the mRNA expression level of caspase-8, -9, -3, and Bax [Figure 3]. The expression levels of these genes in the treated cells were 2.2-fold, 1.7-fold, 1.5-fold, and 2.8-fold higher than that of the untreated cells, respectively. These findings suggested that BOA extract possesses the inhibitory effect on cell proliferation via induction of apoptosis process in gastric cancer cells.

Figure 3: Apoptosis induction in BGC-823 cells by BOA extract. The cells were exposed by BOA extract for one day and total RNA was then collected. The expression levels of caspase-8, -9, -3, and Bax was quantified by qPCR. GAPDH was considered as an internal control. For each group, different letter (a-b) indicates significant difference at p<0.05

Click here to view

Discussion

Dietary products play an significant role in prevention as well as management of cancers.^[12] For the past decades, numerous edible plants have been found due to their potential anticancer activity.^[13] It has evidenced that a healthy diet rich in vegetables and fruits can lower the risk of various cancers.^[14],[15] Notably, Brassicaceae plants, common vegetables consumed worldwide, are known to contain various micronutrients, macronutrients, and secondary metabolites.^[4],[16] These phytochemicals can contribute to their inhibitory activity against a broad range of cancer cells.^[17],[18] In this study, ethanol extract from B. oleracea var. alboglabra extract was determined to suppress the growth of gastric cancer cells at IC₅₀ value of 217.6 ± 2.8 µg/ml. So far, several other Brassicaceae vegetables have been reported for their anticancer effect. Particularly, the methanol extract of cabbage leaves (B. oleracea L. var. capitata f. rubra) was shown to inhibit Hela cells and HepG2 at IC₅₀ values of 23.4 mg/ml and 28.7 mg/ml, respectively.^[19] According to Barakat and colleagues, aqueous extract of B. rapa roots inhibited against the growth of Hela cells (64%) and murine adenocarcinoma cells (63%) at concentrations of 10 mg/ml and 1.25 mg/ml, respectively.^[20] Ethanol extract of B. oleracevaar acephala inhibited HeLa cells growth at IC₅₀ value of 170.7 µg/ml.^[21]B. nigra ethanolic extract was found to inhibit A549 and H1299 at IC₅₀ values of 32 and 25.4 μg/ml for 72 h treatment, respectively.^[22] Besides, the 70% ethanol extract of B. juncea leaves also inhibited HCT116 human colon cancer cells at IC₅₀ value of 253 µg/ml at 72 h time point.^[23] Accordingly, anticancer activity of BOA extract is more potential than that of B. oleracea L. var. capitata f. rubra, B. rapa, and B. juncea. Notably, vegetables species of Brassicaceae was reported to contain various vital compounds, especially glucosinolates and phenolics. These compounds may be responsible for their inhibitory activity against a wide range of cancer types.^[17] Thus, B. oleracea var. alboglabra was suggested to comprise of these secondary metabolites that promote its inhibition on the growth of human gastric cancer cells.

Anti-cancer therapies not only target to cell proliferation, but also focus on suppression of cell migration and invasion. The cancer metastasis is due to moving away from initial side and invading blood circulation that is responsible for 90% of cancer deaths.^[24],[25] Thus, the prevention of cancer cell migration significantly contributes to the blockade of cancer metastasis. Herein, B. oleracea var. alboglabra also exhibited suppressive effect on migration of gastric cancer cells at a dose of 100 µg/ml. It was evidenced that downregulation of matrix metalloproteinase expression leads to the inhibition of extracellular matrix degranulation, and subsequent suppression of cancer cell migration.^{[26],[27],[28]} Moreover, the inactivation of transcription factors including nuclear factor (NF)-κB and activator protein-1 via blocking mitogen-activated protein kinase (MAPKs) and focal adhesion kinase (FAK) pathways also interferes cancer cell migration..^[29] As the result, the inhibition of BOA extract on gastric cancer cell migration may be suggested due to downregulation of matrix metalloproteinase expression as well as MAPKs and FAK pathways.

Apoptosis is a caspase-mediated programmed cell death to eliminate selectively unnecessary cells.^[30] The activation of caspase (-8, -9, and -3) and Bax initiates the process of cell apoptosis.^[31],[32] Therefore, trigger of apoptosis process is regarded as a promising strategy for cancer chemotherapy and is useful indicator for screening of potential anticancer agents derived from natural products.^[33] In this study, the treatment of BOA extract for 24 h could augment the mRNA expression level of caspase-8, -9, -3, and Bax in human gastric cancer cells. It was reported that the anti-cancer effect of various plant extracts, such as Brucea javanica, Camellia sinensis, Cinnamomum kanehirai Hayata, Corni Fructus, Cucurbita ficifolia, Cyperus rotundus L. was due to induction of apoptosis via up-regulating the expression level of caspase-8, -9, -3, and Bax in cancer cells.^[34] Hence, the inhibition of BOA extract against gastric cancer cell growth was suggested due to promotion of apoptosis in gastric cancer cells, thus resulting in the cell death.

Conclusion

In this study, anticancer activity of B. oleracea var. alboglabra againt human gastric cancer cells has been evidenced on in vitro experimental model. These results suggested that crude extract of this vegetable can be developed as a novel component of potential products that is used for the prevention and/or treatment of gastric cancer. However, the further studies should be proposed due to identification of bioactive compounds as well as evaluation of its mechanism of action on cell migration inhibition.

Financial support and sponsorship

This research is funded by Thu Dau Mot University under grant number ĐT.20-011.

Conflict of interest

There is no conflicting interest among authors.

References

1.	Baskar R, Lee KA, Yeo R, Yeoh KW Cancer and radiation therapy: Current advances and future directions. Int J Med Sci 2012;9:193-9.
2.	Ahmad R, Khan MA, Srivastava AN, Gupta A, Srivastava A, Jafri TR, et al. Anticancer potential of dietary natural products: A comprehensive review. Anticancer Agents Med Chem 2020;20:122-236.
3.	Johnson IT Cruciferous vegetables and risk of cancers of the gastrointestinal tract. Mol Nutr Food Res 2018;62:e1701000.
4.	Favela-González KM, Hernández-Almanza AY, De la Fuente-Salcido NM The value of bioactive compounds of cruciferous vegetables (Brassica) as antimicrobials and antioxidants: A review. J Food Biochem 2020;44:1-21.
5.	Gharehbeglou P, Jafari SM Antioxidant components of brassica vegetables including turnip and the influence of processing and storage on their anti-oxidative properties. Curr Med Chem 2019;26:4559-72.
6.	Mandrich L, Caputo E Brassicaceae-derived anticancer agents: Towards a green approach to beat cancer. Nutrients 2020;12:868.
7.	Chang J, Wang M, Jian Y, Zhang F, Zhu J, Wang Q, et al. Health-promoting phytochemicals and antioxidant capacity in different organs from six varieties of chinese kale. Sci Rep 2019;9:20344.
8.	Sun B, Liu N, Zhao Y, Yan H, Wang Q Variation of glucosinolates in three edible parts of Chinese kale (Brassica alboglabra Bailey) varieties. Food Chemistry 2011;124:941-7.
9.	Williamson G, Faulkner K, Plumb GW Glucosinolates and phenolics as antioxidants from plant foods. Eur J Cancer Prev 1998;7:17-21.
10.	Mazloum-Ardakani M, Barazesh B, Moshtaghioun SM, Sheikhha MH Designing and optimization of an electrochemical substitute for the Mtt (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) cell viability assay. Sci Rep 2019;9:14966.
11.	Kwak Y, Ju J Inhibitory activities of perilla frutescens britton leaf extract against the growth, migration, and adhesion of human cancer cells. Nutr Res Pract 2015;9:11-6.
12.	Pal D, Banerjee S, Ghosh AK Dietary-induced cancer prevention: An expanding research arena of emerging diet related to healthcare system. J Adv Pharm Technol Res 2012;3:16-24.
13.	Sak K Cytotoxicity of dietary flavonoids on different human cancer types. Pharmacogn Rev 2014;8:122-46.
14.	Donaldson MS Nutrition and cancer: A review of the evidence for an anti-cancer diet. Nutr J 2004;3:19.
15.	Martínez ME, Jacobs ET, Baron JA, Marshall JR, Byers T Dietary supplements and cancer prevention: Balancing potential benefits against proven harms. J Natl Cancer Inst 2012;104:732-9.
16.	Raiola A, Errico A, Petruk G, Monti DM, Barone A, Rigano MM Bioactive compounds in brassicaceae vegetables with a role in the prevention of chronic diseases. Molecules 2017;23:15.
17.	Higdon JV, Delage B, Williams DE, Dashwood RH Cruciferous vegetables and human cancer risk: Epidemiologic evidence and mechanistic basis. Pharmacol Res 2007;55:224-36.
18.	Fowke JH Head and neck cancer: A case for inhibition by isothiocyanates and indoles from cruciferous vegetables. Eur J Cancer Prev 2007;16:348-56.
19.	Hafidh RR, Abdulamir AS, Abu Bakar F, Jalilian FA, Jahanshiri F, Abas F, et al. Novel anticancer activity and anticancer mechanisms of Brassica oleracea L. var. capitata f. rubra. European Journal of Integrative Medicine 2013;5:450-64.
20.	Ali AM, Barakat NT, Obaid HH, Hassan AA, Abaas ZA Cytotoxic effect of aqueous extract of Brassica rapa roots on cancer cell lines in vitro. J Iraqi Journal of Science 2010;51:550-60.
21.	Sundaram CS, Kumar JS, Kumar SS, Ramesh PLN, Zin T, Rao USM Antibacterial and anticancer potential of brassica oleracea var acephala using biosynthesised copper nanoparticles. Med J Malaysia 2020;75:677-84.
22.	Ahmed AG, Hussein UK, Ahmed AE, Kim KM, Mahmoud HM, Hammouda O, et al. Mustard seed (Brassica nigra) extract exhibits antiproliferative effect against human lung cancer cells through differential regulation of apoptosis, cell cycle, migration, and invasion. Molecules 2020;25:2069.
23.	Kwak Y, Lee J, Ju J Anti-cancer activities of brassica juncea leaves in vitro. Excli J 2016;15:699-710.
24.	Dillekås H, Rogers MS, Straume O Are 90% of deaths from cancer caused by metastases? Cancer Med 2019;8:5574-6.
25.	Guan X Cancer metastases: Challenges and opportunities. Acta Pharm Sin B 2015;5:402-18.
26.	Jabłońska-Trypuć A, Matejczyk M, Rosochacki S Matrix metalloproteinases (mmps), the main extracellular matrix (Ecm) enzymes in collagen degradation, as a target for anticancer drugs. J Enzyme Inhib Med Chem 2016;31:177-83.
27.	Shen KH, Hung JH, Liao YC, Tsai ST, Wu MJ, Chen PS Sinomenine inhibits migration and invasion of human lung cancer cell through downregulating expression of miR-21 and MMPs. Int J Mol Sci 2020;21:3080.
28.	Webb AH, Gao BT, Goldsmith ZK, Irvine AS, Saleh N, Lee RP, et al. Inhibition of Mmp-2 and Mmp-9 decreases cellular migration, and angiogenesis in in vitro models of retinoblastoma. Bmc Cancer 2017;17:434.
29.	Lee CS, Cho HJ, Jeong YJ, Shin JM, Park KK, Park YY, et al. Isothiocyanates inhibit the invasion and migration of C6 glioma cells by blocking Fak/Jnk-mediated Mmp-9 expression. Oncol Rep 2015;34:2901-8.
30.	Cheng X, Xiao Y, Wang X, Wang P, Li H, Yan H, et al. Anti-tumor and pro-apoptotic activity of ethanolic extract and its various fractions from polytrichum commune L.ex hedw in L1210 cells. J Ethnopharmacol 2012;143:49-56.
31.	Chen Q, Kang J, Fu C The independence of and associations among apoptosis, autophagy, and necrosis. Signal Transduct Target Ther 2018;3:18.
32.	Porter AG, Jänicke RU Emerging roles of caspase-3 in apoptosis. Cell Death Differ 1999;6:99-104.
33.	Wang Y, Zhong J, Bai J, Tong R, An F, Jiao P, et al. The application of natural products in cancer therapy by targeting apoptosis pathways. Curr Drug Metab 2018;19:739-49.
34.	Rajabi S, Maresca M, Yumashev AV, Choopani R, Hajimehdipoor H The most competent plant-derived natural products for targeting apoptosis in cancer therapy. Biomolecules 2021;11:534.